Technical Guideline on the Laboratory Testing of the Novel Coronavirus Pneumonia (Second Edition)

[Source]http://www.chinacdc.cn/jkzt/crb/xcrxjb/202001/t20200123_211378.html
【发布时期】1月23日

This technical guideline was formulated to direct various levels of disease control departments and other relevant institutions in conducting laboratory testing of COVID-19. This guideline mainly introduces the RNA detection methods that are relatively mature and easy to implement.

I. Sample collection

(1) Subjects of sample collection.Suspected cases of COVID-19, patients part of a suspected cluster outbreak, other patients who require COVID-19 diagnosis or differential diagnosis, or other environmental or biological samples that require additional screening (such as tracing analysis).

(2) Requirements for sample collection.

1. Technicians engaged in the collection of samples for SARS-COV-2 testing should undergo biosafety training (training certified), and possess relevant laboratory skills. Personal protective equipment (PPE) requirement for sample-collection personnel: N95 respirators, goggles, protective suits, latex gloves, waterproof shoe covers. Double glove if coming into contact with patients' blood, bodily fluids, secretions or excrement.

2. Samples from hospitalized patients should be collected by the medical staff of the hospital under the guidance of professionals of the local CDC.

3. Specimens of close contacts should be collected by local CDC.

4. Based on the requirements of laboratory testing, multiple samples can be taken based on the clinical indications.

(3) Types of samples to collect. Acute respiratory and blood specimens should be collected from each patient. For severely ill patients, prioritize the collection of lower respiratory tract specimens (such as bronchoalveolar lavage), and sample according to clinical indications and sampling intervals.

Other research materials should be collected based on experimental design.

Sample types:

1. Upper respiratory tract samples: throat swabs, nasal swabs, nasopharyngeal aspirate.

2. Lower respiratory tract sample: including sputum, tracheal aspirate, bronchial or alveolar lavage, lung tissue biopsy.

3. Blood samples: ideally, collect anticoagulated acute blood within 7 days after symptom onset. Collect 5ml of blood, preferably after fasting. It's recommended to use vacutainers containing anticoagulants.

4. Serum samples: ideally, collect both acute and convalescent serum. The first serum sample should be collected as early as possible (preferably within 7 days after symptom onset). The second serum sample should be collected 3-4 weeks after symptom onset. Collect 5ml of sample, preferably after fasting. It's recommended to use vacutainers.

(4) Sample collection methods

1. Throat swabs: use 2 plastic swabs with polypropylene fibre heads to simultaneously swab both tonsils and the posterior pharyngeal wall. Insert the heads of the swabs into collection tubes containing 3ml medium. Break off swab shaft and close the cap tightly.

2. Nasal swabs: gently insert 1 plastic swab with a polypropylene fibre head into the nasal cavity to the nasal palate. After a brief pause, slowly withdraw the swab while rotating it. Repeat the procedure in the other nostril with another plastic swab with a polypropylene fibre head. The two aforementioned swabs can be inserted into the same collection tube containing 3ml of medium. Break off the shaft and close the cap tightly.

3. Nasopharyngeal aspirate or tracheal aspirate: use a collection device connected to the negative pressure pump to collect nasopharyngeal mucous or tracheal secretion. Insert the head of the collection device into the nasal cavity or trachea, turn on suction, slowly withdraw the collection tube while rotating to collect mucus. Rinse the collection device once with 3ml of sample collection fluid. (A pediatric catheter connected to a 50ml syringe may be used to replace the collection device.)

4. Deep cough sputum: ask the patient to cough deeply and spit the sputum into a 50ml screw-cap plastic tube containing 3ml of sample collection fluid.

5. Bronchial lavage: insert the head of the collection tube into the trachea through the nose or trach tube (approximately 750px deep), instill 5ml of saline, turn on suction, and slowly withdraw the collection tube while rotating it. Collect the mucus extracted. Wash the collection device once with sample collection fluid. (A pediatric catheter connected to a 50ml syringe may be used to as a collection device.)

6. Alveolar lavage: after local anesthesia, insert the fibre-optic bronchoscope through oropharyngeal or nasopharyngeal route to the middle lobe of the right lung or a lingular segment of the left lung. Wedge the tip of the bronchoscope into a bronchial branching point. Slowly instill 30-50ml sterile saline each time through the biopsy channel, to a total volume of 100-250ml but not exceed 300ml.

7. Blood sample: it's recommended to use a vacutainer with an anticoagulant to collect 5ml of blood sample. Let the sample sit for 30 minutes at room temperature. Centrifuge for 10 minutes at 1500-2000 RPM. Collect plasma and blood cells into separate sterile screw-cap plastic tubes.

8. Serum sample: use vacutainer to collect 5ml of the blood sample. Leave the sample undisturbed at room temperature for 30 minutes. Centrifuge for 10 minutes at 1500-2000 RPM. Collect the serum in a sterile plastic tube with a screw cap.

9. Other materials: use standard collection methods appropriate for experimental design.

(5) Sample packaging.Collected specimens should be packed inside a biosafety cabinet in a BSL-2 laboratory.

1. All specimens should be placed in collection tubes of suitable sizes. The collection tubes should have screw caps with internal O-rings, and be freeze-resistant. Close the cap tightly. Lable the outer container of the specimen with reference number, specimen type, patient's name, and date collected.

2. Place sealed specimens into a plastic bag of suitable size and seal again. Each bag should contain one specimen.

(6) Sample Storage.Specimens for virus isolation and nucleic acid detection should be processed ASAP. Specimens can be stored at 4℃ if they can be processed within 24 hours. Specimens that cannot be processed within 24 hours should be stored at or below -70℃. If there is no -70℃ storage, the samples can be temporarily stored in -20℃ freezers. Serum can be stored for 3 days at 4℃ and for long term at -20℃. Designate dedicated storage or freezer for sample storage. Avoid repeated freeze-thaw during sample transportation.

(7) Sample submission. Samples should be sent to laboratories ASAP after collection. If long-distance transport is required, it's recommended to preserve samples using dry ice.

1. Sample submission. Each province (or autonomous region/municipality) should submit the samples of their first confirmed positive cases and cases in a suspected or confirmed cluster outbreak to the Institute for Viral Disease Control and Prevention of the Chinese CDC, with corresponding submission forms (see attachment).

2. Transport of pathogen and specimen

2.1 Domestic Transport

SARS-COV-2 strains or other potentially infectious materials are assigned to Category A (UN2814), and must be packaged according to Packing Instruction 602 in the International Civil Aviation Organization's Technical Instructions for the Safe Transport of Dangerous Good by Air (Doc9284). Environmental samples are assigned to Category B (UN3373), and must be packaged according to the requirements of Packing Instruction 650 in Doc9284 (International Civil Aviation Organization Technical Instructions for the Safe Transport of Dangerous Goods by Air). Refers to the above standards of packaging when using other modes of transportation.

Transportation of SARS-COV-2 strains or other potentially infectious materials should apply for Shipping Permits according to the Regulation on the Transportation of Highly Pathogenic Microbes (Viruses) or Samples Capable of Infecting Humans (Former Ministry of Health order No. 45).

2.2 International Transport

Standardized packing of SARS-COV-2 strains or samples is required for international transportation. Follow relevant procedures in the Administrative Provisions on the Sanitation and Quarantine of Entry/Exit Special Articles and meet relevant domestic and international requirements.

II. Laboratory testing of SARS-COV-2

The standard method for SARS-COV-2 detection is real-time fluorescent RT-PCR testing. All SARS-COV-2 testing must be performed in laboratories with appropriate setup, and by personnel with relevant technical safety training. Nucleic acid detection in this guideline targets the open reading frame 1ab (ORF1ab) and nucleocapsid protein (N) in the SARS-COV-2 genome.

The following criteria must be met for laboratory confirmation of a positive case:

In the same specimen, two SARS-COV-2 targets (ORF1ab, N) both test positive in specific real-time fluorescent RT-PCR.

A negative result does not rule out SARS-COV-2 infection. Factors that may contribute to a false-negative should be ruled out, including: poor sample quality, such as oropharyngeal samples; samples were collected too early or too late; incorrect storage, transport and processing of specimen; technical limitations such as mutation of the virus or inhibition of the PCR reaction.

III. Real-time fluorescent RT-PCR detection of SARS-COV-2 RNA

(1) Purpose. To standardize the workflow of SARS-COV-2 RNA detection using the real-time fluorescent RT-PCR method, and to ensure the accuracy and reliability of the experimental results.

(2) Scope. Applicable for real-time fluorescent RT-PCR detection of SARS-COV-2 RNA.

(3) Responsibilities.

Testing personnel: Responsible for testing specimens according to these protocols.

Test reviewers: Responsible for reviewing whether the test operation is standardized and whether the test result is accurate.

Department head: Responsible for the comprehensive management of department and verification of the test reports.

(4) Receving and preparing samples. Verify the patient name, gender, age, reference number and test items requisitioned associated with the sample. Abnormal samples should be indicated. Samples should be stored in -70℃ freezers.

(5) Testing items.

1. SARS-COV-2 RNA test (real-time fluorescent RT-PCR method)

It is recommended to use primers and probes targeting the ORF1ab and N gene regions of SARS-COV-2.

Target 1 (ORF1ab):

Forward Primer(F): CCCTGTGGGTTTTACACTTAA

Reverse Primer (R): ACGATTGTGCATCAGCTGA

Fluorescent Probe (P): 5′-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3′

Target 2 (N):

Forward Primer(F): GGGGAACTTCTCCTGCTAGAAT

Reverse Primer (R): CAGACATTTTGCTCTCAAGCTG

Fluorescent Probe (P): 5′-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3′

Refer to test kit manufacture's manual for details on RNA extraction and real-time fluorescent RT-PCR reaction components.

2. Result interpretation

Negative: No Ct value or Ct > 40.

Positive: report as positive when Ct < 37.

Ambiguous: if the Ct value is between 37-40, it's recommended to repeat the experiment. If Ct <40 and the amplification curve clearly peaks, the sample should be interpreted as positive. Otherwise, consider the sample as negative.

IV. Biosafety requirements for laboratory activities involving pathogen

Based on available evidence on the biological characteristics, transmission, pathogenicity, clinical and other information on SARS-COV-2, taking into account that SARS-COV-2 infections cause clustered outbreaks and severe and sometimes fatal diseases, relevant experimental activities are temporarily managed as those concerning pathogenic microbes in Category II. Specific requirements are as follows:

(1) Virus propagation. This refers to activities including virus isolation, propagation, titration, neutralization experiments, live virus and protein purification, virus freeze-drying, and recombinant experiments that generate live virus. Biochemical analyses, serological testing, and immunological testing performed on live viruses, virus-infected cells or their cell extract, and without virus inactivation are regarded as propagative activities. The aforementioned activities should be carried out in Biosafety Level 3 (BSL-3) laboratories qualified to perform the corresponding acitivities. When using viral cultures for RNA extraction, the addition of lysing or inactivating agents must be carried out under the same biosafety containment level as virus propagation. Virus cultures that have been effectively inactivated may be handled in BSL-2 or BSL-1 laboratories.

(2) Animal inoculation experiments. This refers to experimentally inoculating animals with live virus. These experiments should be conducted in (animal) BSL-3 (ABSL-3) laboratories qualified to carry out corresponding activities.

(3) Non-propagative activities with infectious materials. Before effective inactivation, infectious materials that are not propagated may be handled in BSL-2 laboratories for viral antigen detection, serological testing, nucleic acid testing, and biochemical analyses. However, PPE should be worn according to the requirements of BSL-3. Specimens of human and animal tissues that have not been effectively inactivated or fixed may have high virus concentration, thus the containment level for activities involving these specimens should reference that of virus propagation.

(4) Activities with inactivated materials. Infectious material or live virus may be handled in BSL-1 laboratories after effective inactivation.

(5) Activities with non-infectious materials.This refers to activities involving confirmed non-infectious materials, including but not limited to non-infectious viral DNA or cDNA, which can be carried out in BSL-1 laboratories.